Prof_GD_Foster's Avatar

Prof_GD_Foster

@profgdfoster

Retired Prof in Molecular Plant Pathology: Emeritus in Everyway: enjoys life voraciously: enjoys beer: enjoys family & 2 dogs even more than beer(!) L'pool FC through thick & thin

945
Followers
866
Following
316
Posts
14.11.2024
Joined
Posts Following

Latest posts by Prof_GD_Foster @profgdfoster

Post image

πŸ˜‚πŸ˜‚πŸ˜‚πŸ˜‚πŸ˜‚

21.02.2026 18:43 πŸ‘ 2 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0

Great isn’t it πŸ˜€

21.02.2026 15:57 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

There’s no better feeling than being an Irish man living in England when Ireland are stuffing England in the rugby πŸ‰

#heaven #bliss

21.02.2026 15:57 πŸ‘ 3 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0
A tobacco plant showing slight signs of aging after three days of signal-to-noise ratio testing.

A tobacco plant showing slight signs of aging after three days of signal-to-noise ratio testing.

Researchers have designed an electrode that allows for a month-long, noninvasive method of studying physiology and health in a diverse array of plants.

Learn more in this week’s issue of #ScienceAdvances: https://scim.ag/4aay3yP

23.01.2026 22:53 πŸ‘ 43 πŸ” 8 πŸ’¬ 0 πŸ“Œ 1
Preview
Light pollution creates multiple threats to the movement ecology of nocturnal arthropod taxa Light pollution is a major contributing factor to declines in global biodiversity1,2 that is steadily increasing in both severity and spatial extent.3…

Our researchers reveal that light pollution disrupts nocturnal insects & spiders' movements.πŸ™οΈπŸ•·οΈ

Dr Rochelle Meah & Prof Nicholas Roberts highlight two key effects:

1️⃣ Masked day-to-night transitions. πŸŒ™πŸ•·οΈ
2️⃣ Blinded polarized light for navigation.β˜€οΈπŸ¦‹

Read➑️: www.sciencedirect.com/science/arti...

05.01.2026 09:26 πŸ‘ 23 πŸ” 16 πŸ’¬ 0 πŸ“Œ 0

Starting heating it up the day before you need it πŸ™ƒ from personal experience. But they’re amazing

23.01.2026 18:59 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Preview
From Genomic Context to Sensor Design: Computational Identification of AMR Biomarkers in Agriculture (project at Queen's University Belfast) at University of Reading on FindAPhD.com PhD Project - From Genomic Context to Sensor Design: Computational Identification of AMR Biomarkers in Agriculture (project at Queen's University Belfast) at University of Reading, listed on FindAPhD....

Last chance to apply for our funded PhD opportunity. w. Prof. Fredric Coulon @ Cranfield University. This will investigate expansion of ML models for AMR phenotype detection to agriculture settings to create a sensor-ready hit list.
Detail here:
www.findaphd.com/phds/project...

23.01.2026 18:41 πŸ‘ 5 πŸ” 6 πŸ’¬ 0 πŸ“Œ 0
Research Professional Sign-in

UKRI pauses several funding calls amid priorities shake-up

The applicant-led MRC funding calls on pause include research grants, partnership grants and new investigator research grants made available through the council’s research boards.

www.researchprofessional.com/news-article...

19.01.2026 17:24 πŸ‘ 4 πŸ” 17 πŸ’¬ 4 πŸ“Œ 2
Preview
Characterising antibacterial toxins in the food-borne pathogen Listeria monocytogenes at Newcastle University on FindAPhD.com PhD Project - Characterising antibacterial toxins in the food-borne pathogen Listeria monocytogenes at Newcastle University, listed on FindAPhD.com

www.findaphd.com/phds/project... interested in bacterial antagonism? PhD opportunity in our team, see below. Please repost!

23.01.2026 10:33 πŸ‘ 22 πŸ” 31 πŸ’¬ 1 πŸ“Œ 2

Needed hot sausage roll and hot drink as beach very windy and cold πŸ₯Ά

23.01.2026 17:52 πŸ‘ 4 πŸ” 0 πŸ’¬ 0 πŸ“Œ 1
Video thumbnail

Before I retired, colleagues couldn’t believe that I’d just walk away easily. Saying I was so passionate about science and lecturing and my commitment to the university as a whole. You’ll get bored they said.

Err…..no πŸ˜‚

Best life after πŸ™ƒ

23.01.2026 17:50 πŸ‘ 14 πŸ” 0 πŸ’¬ 0 πŸ“Œ 1
Video thumbnail
31.12.2025 23:38 πŸ‘ 3 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Available to a good home: A beer belly...I've been looking after it over Xmas as I can't locate it's owner. It's not damaged..... It follows me everywhere and is very cuddly.

31.12.2025 14:39 πŸ‘ 3 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Preview
New Year Honours: Idris Elba, Torvill and Dean, and Lionesses among those recognised A huge number of people earned gongs this year - here are some of the stand-out names of the 1,157 people recognised.

I turned my mine down again. The just won’t leave me be.

news.sky.com/story/new-ye...

31.12.2025 14:39 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Something for the nerds out there....
CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGGACGTGGGAAGAACCCTCG

31.12.2025 14:33 πŸ‘ 3 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

πŸ’©????????

26.12.2025 21:33 πŸ‘ 0 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0
Amazon.co.uk

Been a while since I published children’s books. But now that our wee man is 22 months & LOVES books, how could Granny & Gramps not write a new one.

Now available in all good book shops and all online sites

Dylan and the Dinosaur πŸ¦–

amzn.eu/d/2vyxxt2

26.12.2025 20:08 πŸ‘ 3 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Preview
Publish or Perish: A Humorous Party Game about Academic Publish Welcome to the chaotic life of academic publishing. In this game, you are a clueless researcher trying to do the one and only thing that matters in your academic life: churning out publications, fast....

Publish or Perish: A Humorous Party Game about Academic Publishing

The Publish or Perish Game is a humorous party game about academic publishing. Players race to publish manuscripts with useless nonsense while sabotaging each other's research!!!!!

publishorperish.games?utm_medium=p...

18.12.2025 11:12 πŸ‘ 2 πŸ” 0 πŸ’¬ 1 πŸ“Œ 1
Post image

One man (little old me) and his dog.

16.12.2025 19:57 πŸ‘ 2 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Preview
Building capacity in vector‐borne plant virus research: The CONNECTED Network Plant viruses spread by insects decimate crop yields globally, causing food security challenges in vulnerable areas, including regions of Africa. Interdisciplinary research is needed to protect futur...

Building capacity in vector-borne plant virus research: The CONNECTED Network

nph.onlinelibrary.wiley.com/doi/10.1002/...

16.12.2025 03:55 πŸ‘ 0 πŸ” 1 πŸ’¬ 0 πŸ“Œ 0
Preview
a man in a pink shirt holds a red cup in his hand ALT: a man in a pink shirt holds a red cup in his hand
10.12.2025 18:57 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Post image
10.12.2025 18:38 πŸ‘ 5 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Oh how us virologists ranted and raved. But no one listened.

β€˜Too little, too late’: damning report condemns UK’s Covid response

20.11.2025 23:52 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Preview
β€˜Too little, too late’: damning report condemns UK’s Covid response Report on handling of pandemic contains stinging criticism of β€˜toxic and chaotic’ culture inside Boris Johnson’s No 10

www.theguardian.com/uk-news/2025...

20.11.2025 23:52 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 1
Post image

NEW from me:

Political hostility, high visa fees and (in the case of the UK) stagnant incomes are making the UK and US less attractive destinations for top international talent.

That steep decline in the appeal of moving to the US after 2016 is πŸ‘€

31.10.2025 14:32 πŸ‘ 1001 πŸ” 405 πŸ’¬ 34 πŸ“Œ 93

Back in gods homeland the great wee Norn Iron. The wind is howling, the wind is horizontal, yep we are deffo home.

27.10.2025 20:17 πŸ‘ 2 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Yep.

24.10.2025 21:56 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Post image

My view as a virologist over 2 years before COVID hit !!

24.10.2025 16:33 πŸ‘ 3 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0
Post image

Very appropriate πŸ˜‚πŸ˜‚πŸ˜‚

My better half would agree πŸ™ƒ

20.10.2025 16:01 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Post image

Our kids never threw out a book their entire lives. Therefore we’ve about 25 years worth stored in our loft for both of them. We’ve finally decided to sort

Finding some classics. Fishing with Foster….The legend begins πŸ˜‚ could change β€˜fishing’ for a wide range of things πŸ˜‚πŸ˜‚πŸ˜‚

20.10.2025 15:14 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0