πππππ
πππππ
Great isnβt it π
Thereβs no better feeling than being an Irish man living in England when Ireland are stuffing England in the rugby π
#heaven #bliss
A tobacco plant showing slight signs of aging after three days of signal-to-noise ratio testing.
Researchers have designed an electrode that allows for a month-long, noninvasive method of studying physiology and health in a diverse array of plants.
Learn more in this weekβs issue of #ScienceAdvances: https://scim.ag/4aay3yP
Our researchers reveal that light pollution disrupts nocturnal insects & spiders' movements.ποΈπ·οΈ
Dr Rochelle Meah & Prof Nicholas Roberts highlight two key effects:
1οΈβ£ Masked day-to-night transitions. ππ·οΈ
2οΈβ£ Blinded polarized light for navigation.βοΈπ¦
Readβ‘οΈ: www.sciencedirect.com/science/arti...
Starting heating it up the day before you need it π from personal experience. But theyβre amazing
Last chance to apply for our funded PhD opportunity. w. Prof. Fredric Coulon @ Cranfield University. This will investigate expansion of ML models for AMR phenotype detection to agriculture settings to create a sensor-ready hit list.
Detail here:
www.findaphd.com/phds/project...
UKRI pauses several funding calls amid priorities shake-up
The applicant-led MRC funding calls on pause include research grants, partnership grants and new investigator research grants made available through the councilβs research boards.
www.researchprofessional.com/news-article...
www.findaphd.com/phds/project... interested in bacterial antagonism? PhD opportunity in our team, see below. Please repost!
Needed hot sausage roll and hot drink as beach very windy and cold π₯Ά
Before I retired, colleagues couldnβt believe that Iβd just walk away easily. Saying I was so passionate about science and lecturing and my commitment to the university as a whole. Youβll get bored they said.
Errβ¦..no π
Best life after π
Available to a good home: A beer belly...I've been looking after it over Xmas as I can't locate it's owner. It's not damaged..... It follows me everywhere and is very cuddly.
I turned my mine down again. The just wonβt leave me be.
news.sky.com/story/new-ye...
Something for the nerds out there....
CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGGACGTGGGAAGAACCCTCG
π©????????
Been a while since I published childrenβs books. But now that our wee man is 22 months & LOVES books, how could Granny & Gramps not write a new one.
Now available in all good book shops and all online sites
Dylan and the Dinosaur π¦
amzn.eu/d/2vyxxt2
Publish or Perish: A Humorous Party Game about Academic Publishing
The Publish or Perish Game is a humorous party game about academic publishing. Players race to publish manuscripts with useless nonsense while sabotaging each other's research!!!!!
publishorperish.games?utm_medium=p...
One man (little old me) and his dog.
Building capacity in vector-borne plant virus research: The CONNECTED Network
nph.onlinelibrary.wiley.com/doi/10.1002/...
Oh how us virologists ranted and raved. But no one listened.
βToo little, too lateβ: damning report condemns UKβs Covid response
NEW from me:
Political hostility, high visa fees and (in the case of the UK) stagnant incomes are making the UK and US less attractive destinations for top international talent.
That steep decline in the appeal of moving to the US after 2016 is π
Back in gods homeland the great wee Norn Iron. The wind is howling, the wind is horizontal, yep we are deffo home.
Yep.
My view as a virologist over 2 years before COVID hit !!
Very appropriate πππ
My better half would agree π
Our kids never threw out a book their entire lives. Therefore weβve about 25 years worth stored in our loft for both of them. Weβve finally decided to sort
Finding some classics. Fishing with Fosterβ¦.The legend begins π could change βfishingβ for a wide range of things πππ